Challenge for those that believe in billions of years for the age of things. Give anything that is more than 6000 years old. NO ASSUMPTIONS ALLOWED.

A collection of molecules capable of utilizing external energy thus reversing local entropy and replicating itself thus providing the basis for its future evolution. Your sky daddy might even be responsible for it.
 
A collection of molecules capable of utilizing external energy thus reversing local entropy and replicating itself thus providing the basis for its future evolution. Your sky daddy might even be responsible for it.
Replicating
that is not going to create a specific large sequence of aminos or nucleotides.

Here is replication
ZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZ

Here is a specific sequences
AGATTTCGTCGATGCGATCGTCGTATACGTACGTACGTCCGTATGCGTAATCGAACGTTGCATGCGTCGAACGTCGTACGTCGATGCATGCGTTGCATGCGTAATCGTACTGCATGCTACTCTGCGATCGTATACGTGCGT
 
Replicating
that is not going to create a specific large sequence of aminos or nucleotides.

Here is replication
ZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZ

Here is a specific sequences
AGATTTCGTCGATGCGATCGTCGTATACGTACGTACGTCCGTATGCGTAATCGAACGTTGCATGCGTCGAACGTCGTACGTCGATGCATGCGTTGCATGCGTAATCGTACTGCATGCTACTCTGCGATCGTATACGTGCGT
I would check what replication means, because you clearly don't know.
 
I would check what replication means, because you clearly don't know.
It means duplicate or repeat.

Here is replication
ZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZ

Here is a specific sequences
AGATTTCGTCGATGCGATCGTCGTATACGTACGTACGTCCGTATGCGTAATCGAACGTTGCATGCGTCGAACGTCGTACGTCGATGCATGCGTTGCATGCGTAATCGTACTGCATGCTACTCTGCGATCGTATACGTGCGT
 
A collection of molecules capable of utilizing external energy thus reversing local entropy and replicating itself thus providing the basis for its future evolution. Your sky daddy might even be responsible for it.
And what was the molecular formulas of these?
 
A collection of molecules capable of utilizing external energy thus reversing local entropy and replicating itself thus providing the basis for its future evolution. Your sky daddy might even be responsible for it.
Mammals with different chromosome numbers cannot produce fertile offspring,
So all mammals should have the same chromosome count.

That destroys macroevolution and refutes the dating of the rock layers.

 
Here is simple challenge for those that believe in billions of years for the age of things. Give real evidence of anything that is more than 6000 years old. NO ASSUMPTIONS ALLOWED.

Actually, without making ANY assumptions, it is impossible to prove that the universe isn't just ten minutes old. That's because it is possible that God created the entire universe ten minutes ago and implanted memories in all of us of the times before when we were created. Similarly He could have created all the physical world ten minutes ago with all the internal evidence that would lead us to think it was 6,000 years old or 4.5 billion years old, even though it is only ten minutes old. So you've got to allow some assumptions.
 
Actually, without making ANY assumptions, it is impossible to prove that the universe isn't just ten minutes old. That's because it is possible that God created the entire universe ten minutes ago and implanted memories in all of us of the times before when we were created. Similarly He could have created all the physical world ten minutes ago with all the internal evidence that would lead us to think it was 6,000 years old or 4.5 billion years old, even though it is only ten minutes old. So you've got to allow some assumptions.
I can.
I started a stopwatch on my phone and let it go for 20 minutes.
We do it with our oven too,
 
I can.
I started a stopwatch on my phone and let it go for 20 minutes.
We do it with our oven too,
Ah, you only think you started it 20 minutes ago. Your memory of the first ten minutes of that time period was implanted ten minutes ago as you were being created, and the world was created with your timer already running. So how about stating which assumptions are allowed so as to preclude the world being created ten minutes ago or ten days ago.
 
Ah, you only think you started it 20 minutes ago. Your memory of the first ten minutes of that time period was implanted ten minutes ago as you were being created, and the world was created with your timer already running. So how about stating which assumptions are allowed so as to preclude the world being created ten minutes ago or ten days ago.
Millions have proved your nonsense false.
I have been having birthdays every year since I can remember.
 
Hey another unwarranted and unevidenced assumption from the prince of illogic.
Prove your memory is infallible!
 
Even in mathematics there are assumptions at the base of ever mathematical theory. They are called postulates. In geometry there are Euclid's postulates. In the theory of natural numbers there are Peano's postulates. But in this area of physical science / theology, we are unlikely to come up with any such formal postulates. Therefore I suggest an informal postulate from which we might be able to establish truth. (I refrain from using the word "prove" because it really doesn't apply outside of mathematics. Even in physical science we don't "prove" anything. We simply accumulate supporting evidence for a theory - the more the better. So here is my postulate: "We will call something 'true' if it agreed by an overwhelming majority of people who have seen all the available evidence and have concluded it is true." If that postulate is acceptable, then my idea of a universe created ten minutes ago would not be deemed true because no one would seriously accept it as consistent with their experience. That postulate (assumption) would also allow the use of radioactive decay as a valid means of identified the age of certain substances. And from those tests, substances will be found that measure to be older than 6000 years.
 
Biblical passage please

___
.
Thus saith God the Lord, he that created the heavens, and stretched them out; he that spread forth the earth, and that which cometh out of it; he that giveth breath unto the people upon it, and spirit to them that walk therein: - Isa 42:5

And the great dragon was cast out, that old serpent, called the Devil, and Satan, which deceiveth the whole world: he was cast out into the earth, and his angels were cast out with him. - Rev 12:9
 
Thus saith God the Lord, he that created the heavens, and stretched them out; he that spread forth the earth, and that which cometh out of it; he that giveth breath unto the people upon it, and spirit to them that walk therein: - Isa 42:5

Yes. The Bible says God stretched out the universe. Many call this stretching - the big bang.

And the great dragon was cast out, that old serpent, called the Devil, and Satan, which deceiveth the whole world: he was cast out into the earth, and his angels were cast out with him. - Rev 12:9

It's true. Satan deceives, and the Bible says that God stretched out, and continues to stretch out the heavens.

Satan did not deceive anyone with the physics of inflation. God put in place all of the fixed laws.

"But I, the LORD, make the following promise: I have made a covenant governing the coming of day and night. I have established the fixed laws governing heaven and earth." Jeremiah 33:25 NET

___
.
 
Yes. The Bible says God stretched out the universe. Many call this stretching - the big bang.



It's true. Satan deceives, and the Bible says that God stretched out, and continues to stretch out the heavens.

Satan did not deceive anyone with the physics of inflation. God put in place all of the fixed laws.

"But I, the LORD, make the following promise: I have made a covenant governing the coming of day and night. I have established the fixed laws governing heaven and earth." Jeremiah 33:25 NET

___
.
The Big Band would be Gen 1:1 plus let there be light.
The stretching happened after.
And Satan borrowed all 3 to fool the AOS “scientists“
 
Back
Top